Preparation
of Plasmid DNA for Sequencing
Preparation of PCR Products for
Sequencing
Preparation of Lambda and Cosmid
Clones for Sequencing
Sequencing Primers -
Concentration, Design, and Choices
We require that the DNA samples be named only with
English alphanumeric characters and underscores. Please do not use Greek
letters, dashes, dots, colons, slashes, nor signs such as #. This
simplifies the naming of the DNA sequence files so that they are acceptable to
both IBM/DOS/Windows and Mac formats. Please limit the clone name to a
maximum of 8 characters and the primer name to 5 characters.
Numerous E. coli strains are used for cloning of DNA;
however, two factors that interfere with obtaining optimal DNA sequencing
results are cell wall polysaccharides and intrinsic DNA nucleases. The
ideal strain from which to prepare plasmid DNA for sequencing is DH5a, because
it has low amounts of polysaccharides and is mutant in the gene for
endonuclease I (i.e., it bears the endA1-minus allele). Non-suitable
strains are: NM544, C600, BL21, TG1, JM101. The strains MV1190, XL1 Blue,
and JM109 give variable results due to slow growth and higher amounts of
polysaccharides, and do not increase plasmid yields in response to Terrific
Broth medium.
The E. coli vectors of the pUC, pGEM, or pBluescript
series yield high amounts of plasmid DNA per cell (>300 copies per
cell). Generally, vectors derived from pBR322 or pACYC/p15A series of
plasmids have much lower copy numbers (= 1-30 copies per cell). Very
large DNA inserts (>20 kb) can reduce copy number for both types of vectors
and certain inserts can be toxic to the cell. Consider these factors when
choosing the plasmid for cloning the DNA to be sequenced and the size of
culture needed to isolate sufficient amounts of plasmid DNA. If you
submit a culture for plasmid isolation, it is important to indicate the type of
plasmid (high copy or medium-low copy). We highly recommend that the
customer confirm that the E. coli transformant brought to the Core does
in fact bear the correct plasmid before submitting it for DNA purification and
sequencing
The concentration and care of the antibiotic used to maintain plasmids in bacterial strains is a critical step in obtaining optimal amounts of plasmid DNA. We recommend growing the bacterial culture in either Luria Broth (LB with the usual amount of NaCl, 1%) or Terrific Broth, and if the plasmid selection is ampicillin resistance, use either 100 micrograms/mL ampicillin on plates or 50 micrograms/mL for liquid cultures or 50 micrograms/mL of the more stable carbenicillin in both plates or liquid.
Adequate aeration of bacterial cultures is
ensured with a liquid to container volume ratio of 1:5 and rotary shaking at
250 rpm. Most bacterial strains grow optimally at 37°C with optimal
yields at 18 + hours, depending on the aeration rate. Often, 12-16
hours can be too little time for satisfactory yields of plasmid DNA.
Prolonging growth to 18-20 hours can increase plasmid yields, but again this
will depend on the aeration rate. Long-term storage of cultures on ampicillin
plates is to be avoided; colonies become quite clumpy and lose viability due to
cell lysis.
If the Core is to purify the DNA for you from
your clone, please use fresh cultures on fresh plates of selective medium and
ALWAYS streak out one (1) SINGLE colony sufficiently to produce single
well-separated colonies. This will help ensure we obtain a unique
sequence. Again, since we do not know the structure of your plasmid, be
certain of what you give us to sequence.
We use ABI's FS Recombinant AmpliTaq polymerase and dRhodamine and BigDye version 1.1 dye-terminator-based cycle sequencing kits to sequence DNA. High DNA purity is essential for optimal results. We recommend using alkaline lysis and the Qiagen products and protocols for purifying plasmid DNA, as MODIFIED by the Core; contact the Core for details. Boiling preps, unless subsequently cleaned up, usually do not produce DNA suitable for sequencing, because of the high amount of detergent left in the sample. It is also critical that the samples be free of RNA. A good alternative, especially for large amounts of plasmid DNA, is the method of Feliciello and Chinali (Anal. Biochem. 212: 394-401, 1993), when followed by precipitation of DNA with polyethylene glycol, a 70% ethanol rinse, and a re-precipitation and rinse with ethanol. Carefully remove the supernatants so as not to lose the sample. We have our detailed version of this protocol available for Core customers.
Other protocols for preparing DNA using
glass-based or diatomaceous-earth- or glass-based resins (e.g., Promega's
Wizard or Wizard-Plus, or Clontech's S.N.A.P. miniprep kit) can produce
suitable results, if one ensures that all EDTA, ethanol, and NaCl have been
removed from the DNA prep before resuspending the dried DNA pellet in sterile
and pure water or 10 mM Tris-HCl, pH 8. The solution originally used to
elute DNA from the WizardTM columns of Promega contained EDTA and sodium
chloride, both shown to interfere with AmpliTaq-based cycle sequencing. Therefore,
if you use one of these older protocols, precipitate the eluted DNA with sodium
or potassium acetate and either ethanol or isopropanol at ROOM TEMPERATURE,
rinse the DNA pellet with 70-80% ethanol at ROOM TEMPERATURE, and dry the
pellet. Carefully remove the supernatants so as not to lose the pelleted
sample.
Remember: DNA pellets can be accidentally lost after ethanol
precipitation and especially after isopropanol precipitation. If you need
to concentrate a DNA sample resuspended in water, you may evaporate the DNA
solution and resuspend it in the desired volume of water. However,
remember you will also concentrate any contaminants present.
With all plasmid isolation methods involving
alkaline lysis, it is critical to keep the incubation time in the alkaline
solution short (< 5 minutes at room temperature) before neutralization of
the solution and precipitation of the chromosomal DNA and cell debris with the
acetate solution on ice. Longer times produce a DNA conformation that
migrates ahead of the main covalently closed circular (CCC) band and it is
probably denatured and may not be digestible by certain restriction
enzymes. After centrifugation to remove the cellular debris and genomic
DNA, precipitate the DNA with isopropanol at ROOM TEMPERATURE and rinse with
70% ethanol at ROOM TEMPERATURE to remove excess salts. Dry the
pellet. DNA template submitted for sequencing should be resuspend in
water or 10 mM Tris-HCl (pH 8). TE (10 mM Tris-HCl, 1 mM EDTA, pH 8) should not
be used since the EDTA can inhibit the AmpliTaq polymerase by chelating the
Mg2+ in the cycle-sequencing reaction.
DNA concentration is often determined by measuring the absorbance of a DNA solution at 260 nm (A 260nm) with subtraction of the absorbance at 320 nm (A 320nm) to correct for light scattering due to debris. The actual measured A 260nm value should be between 0.2 and 1.0, using a 1 cm cuvette and the sample should not contain RNA or nucleotides. NOTE: Mini-preps of DNA are too dilute to accurately measure the absorbance in this manner and still have enough of the sample left for sequencing.
Therefore, we recommend that a sample of the
DNA (ideally, 1.0 microliter for plasmid DNA and 3-5 microliters for PCR
products and restriction fragments) be electrophoresed on a 0.75% agarose gel
with either 1 X TBE of 1 X TAE buffer containing 0.25 micrograms ethidium
bromide per mL) along with a known amount of similar sized DNA and compare the
intensity of the ethidium bromide bands of your DNA sample against that of the
bands present in the sample of known concentration. As standard(s), one
can use an aliquot of either a maxi- or midi-prepared plasmid DNA that has been
accurately quantified or one of three commercially available mass
standards. These ladders of mass standards are: PGC Scientifics
Gene Choice DNA Ladder I (Cat. No. 62-6108-00), which we sell and you thereby
avoid paying shipping costs. New England Biolabs (NEB) also have a 1KB
Ladder (Cat. No. N32325), which is available in the NEB freezer in the UCHSC
School of Medicine Room 5626. Inter-Mountain Scientific Company (ISC
Bioexpress) sells the Gene Mate Quanti-Maker 1 kb Ladder (Cat. No. C-5087-200),
which is very similar to the mass ladder from PGC Scientifics.
Agarose gel electrophoresis will ensure that
DNA is present in the expected/desired amounts and it is free of RNA and
genomic DNA. Photograph the gel without over exposing so that the band
intensity is proportional to the amount of DNA. Also, it is critical that
the amount of RNA in the DNA sample be minimal. Even a slightly visible
RNA band on a gel can indicate that 50% or more of the nucleic acid in the
sample is RNA. This is due to RNA not binding ethidium bromide as efficiently
as double-stranded DNA.
For the Premium Full-Service sequencing, we require each plasmid template to be dissolved at a concentration of 150 nanograms/microliter in water or Tris-HCl (pH8) per sequencing reaction/primer combination. Kindly provide us with minimum of 5 microliters of DNA solution per reaction at this concentration in a 1.5 mL microcentrifuge tube. The extra amount DNA is so that we have enough for repeats or pipetting errors. We will gladly return whatever we do not use; however, we will discard DNA samples and primers after one calendar month. Please indicate the concentration of the DNA on the order form.
For uncloned PCR products or linear
restriction fragments, we need that the DNA samples have a concentration of 15
nanograms/microliter.
For Lambda, PAC, and BAC DNA, we need the DNA
concentration be 500 nanograms per microliter and the primer concentration be
100 micromolar. Please do not dilute and we will gladly provide advice on protocols
for the isolation of these DNAs.
DNA templates with high G+C content, palindromes (e.g., tRNA genes, transcription terminators, iRNA), or homopolymeric regions can be difficult to sequence. AmpliTaq FS can have difficulty in polymerizing through such structures, because the sequencing reaction mixtures contain dITP instead of dGTP; dITP is used to minimize such electrophoretic artifacts as sequencing compressions. However, if we know of potential problems beforehand, we have developed some unpublished methods that can increase the likelihood of successfully sequencing through these regions. Please indicate at the time of ordering the sequencing whether a DNA sample is known to contain such features and whether you wish us to modify our normal protocol for your samples.
Although we can use a Big Dye sequencing kit
containing dGTP to sequence through difficult regions, it has the drawback that
compressions will occur in the sequencing results and therefore this kit is
only used for very difficult templates. PLEASE NOTE, we do not guarantee that
the modified reactions will produce satisfactory sequencing results.
Use the back button to return to the top of this page.
PCR products are linear DNA fragments and not ones that have been cloned into a vector after amplification. Once the DNA is cloned, it is considered to be plasmid DNA. To successfully sequence PCR DNA products they must electrophorese as clear, distinct, and unique bands after one round of PCR amplification. If more than one product is produced, the desired product should be gel purified and tested for homogeneity (e.g., complete digestion with a specific restriction enzyme). Be aware that two rounds of PCR amplification (e.g., nested PCR or re-amplification with the original primers) can introduce heterogeneities in to the amplified DNA fragment and therefore produce mixed sequences.
To sequence a mixture of DNA fragments, use
of a nested primer for sequencing may improve the success rate. If a pair
of primers produces a mixture of similar size fragments, a second primer known
to hybridize only to and within the desired fragment can be used to sequence
the PCR product with some degree of success.
It is absolutely critical to remove or destroy the primers and the dNTPs after PCR amplification; otherwise, sequencing will either not produce a signal due to excess dNTPs in the reaction or the different primers will give multiple (i.e., mixed) sequences. The Microcon_ PCR filter units from Millipore (catalogue number UFC7PCR50 or UFC7PC250) are simple to use and work well for purifying PCR products from a reaction. Avoid the use of oil in the PCR reactions.
Alternatively, Qiagen's QIAquick PCR
Purification spin columns and similar products work well to purify DNA
fragments away from nucleotides, primers, and oil used to prevent evaporation
during PCR. By either method, if the primers are long or can form dimers,
they may not be totally removed and can thus produce spurious results.
Qiagen's QIAquick Gel Purification spin columns work well to extract DNA
fragments from agarose, if used according to modifications available from the
Core. With both of Qiagen's products, the DNA should be eluted with
water, not TE. If eluted with TE, precipitate the DNA with ethanol and a
salt (e.g., Na-acetate), rinse the pellet with 70% ethanol, dry, redissolve in
water and quantify on an agarose gel. Millipore offers an alternative
method for purifying DNA fragments from agarose (Amicon Ultrafree-DA spin
columns, Millipore catalog no. 42600).
The primers used to produce the PCR product can be used successfully to sequence a PCR DNA fragment. However, even gel-purified PCR fragments may contain more than one product as well as inhibitory compounds from the agarose or polyacrylamide. Therefore, it may be preferable to use internal "nested" primers (i.e., ones which anneal to the desired sequence between the original PCR primers) to increase the specificity of the sequencing reactions.
Use the back button to return to the top of this page.
We recommend using a modification of the protocol by Lee and Clark (Biotechniques 23: 598-600, 1997) with the Qiagen Midi kit. Supply the sequencing primers at 100 micromolar. For details, contact the DNA Sequencing Core.
Cosmid DNA can be isolated by alkaline lysis followed by either a PEG precipitation step or by using the Qiagen Plasmid Kit. The simple plasmid preparation method of Feliciello and Chinali (Analytical Biochemistry 212: 394-401, 1993) combined with a PEG precipitation step (a copy of our modification of this method is available upon request) can also produce excellent template DNA. Remember to increase the culture volume to compensate for the lower copy number of cosmid vectors as compared to the pUC / pGEM / pBluescript series of vectors. Supply the sequencing primers at 50 micromolar.
These large cloned DNAs are more difficult to sequence. We recommend using Qiagen kits specific for isolating these DNAs. Supply the sequencing primers at 100 micromolar. Because of the size and complexity of the DNA, it may be easier to sequence the DNA that has been digested with restriction enzymes, so long as a restriction site is not located between the primer site and the region to be sequenced.
For each reaction, we need 5 microliters of 500 nanograms per microliter of DNA in water. Please confirm the DNA concentration on an agarose. Do not freeze these large DNAs as this may make them more difficult to dissolve. Please note on the order form if your DNA is one of these types.
Use the back button to return to the top of this page.
For most sequencing experiments, we require primers dissolved in water or Tris-HCl (pH 8) at 5 micromolar. For sequencing of large DNA templates (phage, PACs, BACs, cosmids, the primer should be at 100 micromolar . Please note the concentration units (i.e., PLEASE do not use micrograms per milliliter!). Please supply enough primer for three reactions of 1 microliter each with a minimum of 10 microliter of each primer.
Many commercially available computer programs can help circumvent several problems encountered in primer design. We have in-house programs for primer design. Primers should have a 40-65% GC content, and 16-30 bases in length (depending on Tm). A C or G at its 3' end provides a stronger bond to the target, but an A or T at the 3' end may provide higher specificity of annealing. Those that can form hairpins or dimerize with themselves should be avoided. To prevent primer mispairing and slippage during annealing, avoid stretches of 5 or more identical bases (especially G or C), in particular, at the 3' end of the primer. Detailed considerations and recommendations for both sequencing and PCR primers are available on request.
We can supply the
following primers for Premium Service sequencing your DNA sample.
|
Primer |
Length |
Sequence (5 '--3 ') |
Tm / Td |
|
M13 / pUC Forward |
18 |
TGTAAAACGACGGCCAGT |
57 °C / 54 °C |
|
M13 / pUC Reverse |
22 |
TCACACAGGAAACAGCTATGAC |
58 °C / 64 °C |
|
T7 (Promega) |
20 |
TAATACGACTCACTATAGGG |
46 °C / 56 °C |
|
T7-neo (Core) |
19 |
TAATACGACTCACTATAGG |
41 °C / 52 °C |
|
T3 (Promega) |
20 |
ATTAACCCTCACTAAAGGGA |
53 °C / 56 °C |
|
SP6 (Core version) |
23 |
GCTATTTAGGTGACACTATAGAA |
50 °C / 62 °C |
|
T7 terminator |
19 |
GCT AGT TAT TGC TCA GCG G |
53 °C / 56 °C |
Important Notes
The sequences of these primers have been optimized
for cycle sequencing and will match most vectors; however, always check your
vector sequence and clearly indicate which vector and primer combination you
desire. Please note that the primer annealing during cycle sequencing is
done at 50 °C.
There are two different T7 primers
commercially available and they are not cross compatible. Check to see
whether the sequence of our primer will work with your template.
Tm was determined by calculating the stacking
energy method of Breslauer et al., Proc. Nat. Acad. Sci. 83, 3746-50,
1986
Td was determined by the Wallace et al.
(1979) equation: Td (in °C) = 2° x (number A + T) + 4° x (number G + C).
Use the back button to return to the top of this page.